دانشکده علوم
پایان نامهی کارشناسی ارشد در رشتهی زیست شناسی – سلولی مولکولی
مطالعه ارتباط بین چند شکلی های حذف و اضافه موجود در اینترون 3 ژن XRCC4 و اینترون 16 ژن ACE
و خطر ابتلا به اسکیزوفرنیا
به کوشش
هاجر مظاهری
استاد راهنما
دکتر مصطفی سعادت
شهریور 1392
به نام خدا
اظهار نامه
اینجانب هاجر مظاهری (900502) دانشجوی رشته ی زیست شناسی گرایش سلولی ومولکولی دانشکده ی علوم دانشگاه شیراز اظهار می کنم که این پایان نامه حاصل پژوهش خودم بوده و در جاهایی که از منابع دیگران استفاده کرده ام، نشانی دقیق و مشخصات کامل آن را نوشته ام. همچنین اظهار می کنم که تحقیق و موضوع پایان نامه ام تکراری نیست و تعهد می نمایم که بدون مجوز دانشگاه دستاوردهای آن را منتشر ننموده و یا در اختیار غیر قرار ندهم. کلیه حقوق این اثر مطابق با آیین نامه مالکیت فکری و معنوی متعلق به دانشگاه شیراز است.
نام و نام خانوادگی: هاجر مظاهری
امضا و تاریخ:
تقدیم به پدر و مادر مهربانم
و
همسر عزیزم، عمادالدین
و
طراوت زندگی ام، باران
سپاسگزاری
سپاس يگانه اي را که زمين بر گرد عرش کبريائي او ميگردد و آسمان به رنگ مهرباني اوست
معبودي که دريا در برابر شکوهش پيشاني به سنگ مي سايد و کوه در برابر عظمتش بر جاي مانده است.
سپاس که با علم و ايمان به حيات دنيا و عقبايم معنا بخشيدي!
در طول مراحل مختلف انجام اين پژوهش، از همكاري افراد بزرگواري برخوردار بوده‌ا‌‌م كه لازم مي‌دانم از يكايك اين عزيزان مراتب تقدير، تشكر و سپاسگزاري را به جاي آورم.
از مادر عزيز و مهربان و پدر دلسوزم که همواره با صبر و بردباري و تشويق و دلگرمي هايشان اميد به آينده را در من تقويت نمودند، تشکر ويژه کرده و دستانشان را بابت همه چيز
مي بوسم.
مراتب سپاس و قدردانی خود را نسبت به زحمات بی دریغ استاد راهنماي ارجمندم جناب آقاي دكتر مصطفی سعادت، به خاطر تقبل راهنمائي اينجانب، صبر و حوصله فراوان و منابع مفيدی که در اختیار بنده گذاشتند، ابراز می دارم.
راهنمايي‌هاي ارزشمند، سازنده و زحمات اساتید مشاور ارجمندم جناب آقای دکتر ایرج سعادت و سرکار خانم دکتر راحله مسعودی را در راستاي پيشبرد پايان نامه اينجانب ارج
مي نهم.
در پایان از اساتید فرهیخته گروه زیست دانشگاه شیراز و کلیه عزیزانی که مرا در تالیف این پزوهش یاری کردند، نهایت تشکر را دارم.
چکیده
مطالعه ارتباط بین چند شکلی های حذف و اضافه موجود در اینترون 3 ژن XRCC4 و اینترون 16 ژن ACE و خطر ابتلا به اسکیزوفرنیا
به کوشش
هاجر مظاهری
اسکیزوفرنیا یک اختلال روانی شدید همراه با نشانه های مثبت و منفی می باشد. بر اساس مطالعات سبب شناسی و ژنتیکی، وراثت نقش مهمی در بروز بیماری اسکیزوفرنیا دارد همچنین این مطالعات به نقش تعدادی از ژن ها در بروز بیماری اسکیزوفرنیا اشاره می کنند. مکانیسم های ترمیمی در انسان از DNA در برابر آسیب های درون زا و برون زا حفاظت می کنند. ژن XRCC4 نقش مهمی در مسیر ترمیمی NHEJ بازی می کند و NHEJ مسیر اصلی در ترمیم شکست های دو رشته ای DNA است. انواع پلی مورفیسم های موجود در ژن های ترمیمی DNA، قادرند ظرفیت ترمیم DNA و کارایی پروتئین حاصله را تغییر دهند که از این طریق ممکن است در ابتلا به اسکیزوفرنیا نقش داشته باشند. با توجه به عملکرد ژن ACE بر روی نوروترانسمیترها از جمله دوپامین می توان این ژن را به عنوان یک عامل مهم در بروز بیماری های روانی در نظر گرفت. ارتباط بین چندشکلی های حذف و اضافه موجود در اینترون 3 ژن XRCC4 و اینترون 16 ژن ACE با اسکیزوفرنیا در جمعیتی شامل 363 فرد مبتلا به اسکیزوفرنیا و 363 فرد سالم مورد بررسی قرار گرفت. پس از انجام آنالیزهای رگرسیون لجستیک رابطه معناداری بین چند شکلی های ژنتیکی حذف و اضافه موجود در ژن های XRCC4 ( (OR= 0.92, 95%CI =0.66-1.27, P =0.618و
ACE (OR= 0.94, 95% CI= 0.70-1.27, P = 0.702) و ابتلا به بیماری اسکیزوفرنیا وجود نداشت.
کلید واژه: اسکیزوفرنیا، حذف و اضافه
فهرست مطالب
عنوان صفحه
فصل اول: مقدمه
1-1- اسکیزوفرنیا 2
1-1-2- علائم اسکیزوفرنیا 3
1-1-3- سبب شناسی اسکیزوفرنیا 4
1-1-3-1- عوامل ژنتیکی 4
1-1-3-2- عوامل بیوشیمیایی 5
1-1-3-3- عوامل محیطی 6
1-1-3-4- آسیب شناسی عصبی 7
1-1-4- انواع اسکیزوفرنیا8
1-1-5- درمان اسکیزوفرنیا 8
1-2- ژن ترمیمی XRCC4 9
1-3- ژن ACE 11
1-4- هدف 12
فصل دوم: مروری بر تحقیقات گذشته
2-1 مطالعات زیست شناختی اسکیزوفرنیا 14
2-2- مطالعات انجام شده در رابطه با XRCC4 14
2-3- مطالعات انجام شده در مورد ژن ACE 15
2-4- فرضیات 16
عنوان صفحه
فصل سوم: وسایل ، مواد و روشها
3-1- نمونه گیری18
3-2- وسایل مورد نیاز18
3-3- مواد مورد نیاز19
3-4- تهیه محلول ها……………………………………………………………………….20
3-5- استخراج DNA از خون محیطی به روش جوشاندن (Boiling) 20
3-6- واکنش زنجیره ای پلیمراز (PCR) 20
3-7- تعیین ژنوتیپ ژن XRCC4 21
3-8- تعیین ژنوتیپ ژن آنژیو تنسین 22
3-9- الکتروفورز23
3-10- رنگ آمیز ژل24
3-11- تحلیل آماری25
فصل چهارم: نتایج
4-1- مشخصات افراد شرکت کننده در مطالعه 27
4-2- نتایج حاصل از بررسی عوامل خطر کیفی دخیل در اسکیزوفرنیا 27
4-3- نتایج حاصل از بررسی چند شکلی D/A در ژن XRCC4 28
4-3-1- مقایسه فراوانی های ژنوتیپی و آللی بین دو گروه شاهد و بیمار 28
4-3-2- مقایسه فراوانی های ژنوتیپی چند شکلی I/D ژن XRCC4 بین
دو گروه شاهد و بیمار، پس از تعدیل عوامل خطر اسکیزوفرنیا 29
4-4- نتایج حاصل از بررسی چند شکلی I/D در ژن آنژیوتنسین 31
4-4-1- مقایسه فراوانی های ژنوتیپی و آللی بین دو گروه شاهد و بیمار 31
عنوان صفحه
4-4-2- مقایسه فراوانی های ژنوتیپی چند شکلی I/D ژن آنژیوتنسین،
بین دو گروه شاهد و بیمار، پس از تعدیل عوامل خطر بیماری اسکیزوفرنیا 32
فصل پنجم: بحث
5-1- بحث و نتیجه گیری کلی35
فهرست منابع و مآخذ
منابع فارسی 40
منابع انگلیسی 41
فهرست جدول ها
عنوان صفحه
جدول 3-1 ، مواد مورد نیاز برای تهیه مخلوط واکنش PCR 21
جدول 3-2، برنامه تنظیم شده برای واکنش PCR جهت تکثیر ژن XRCC4 . 21
جدول 3-3، باندهای حاصل از PCR در ژنوتیپ های XRCC4 22
جدول 3-4، برنامه تنظیم شده برای واکنش PCR جهت تکثیر ژن آنژیوتنسین22
جدول 3-5، باندهای حاصل از PCR، ژنوتیپ های آنژیوتنسین 23
جدول 4-1، بررسی عوامل خطر کیفی دخیل در اسکیزوفرنیا24
جدول 4-2، فراوانی های ژنوتیپی و آللی چند شکلی ژنتیکی I/D ژن XRCC4
در دو گروه شاهدو بیمار 28
جدول 4-3، مقایسه فراوانی های ژنوتیپی و آللی چند شکلی I/D ژن XRCC4
بین دو گروه شاهد و بیمار 29
جدول 4-4، مقایسه فراوانی های ژنوتیپی چند شکلی I/D ژن XRCC4 ،
پس از تعدیل سیگار به عنوان عامل خطر اسکیزوفرنیا 29
جدول 4-5، مقایسه فراوانی های ژنوتیپی چند شکلی I/D ژن XRCC4 ،
پس از تعدیل اثر سابقه بیماری در اقوام بیمار، به عنوان عامل خطر اسکیزوفرنیا 30
جدول 4-6، مقایسه فراوانی های ژنوتیپی چند شکلی I/D ژن XRCC4 ،
پس از تعدیل ازدواج خویشاوندیوالدین بیمار، به عنوان عامل خطر اسکیزوفرنیا 30
جدول 4-7، فراوانی های ژنوتیپی و آللی چندشکلی ژنتیکی I/D ژن آنژیوتنسین
در دو گروه شاهد و بیمار 31
عنوان صفحه
جدول 4-8، مقایسه فراوانی های ژنوتیپی و آللی چند شکلی I/D ژن آنژیوتنسین،
بین دو گروه شاهد و بیمار 32
جدول 4-9، مقایسه فراوانی های ژنوتیپی چندشکلی I/D ژن آنژیوتنسین، پس از
تعدیل سیگار به عنوان عامل خطر اسکیزوفرنیا 32
جدول 4-10، مقایسه فراوانی های ژنوتیپی چندشکلی I/D ژن آنژیوتنسین، پس از
تعدیل اثر سابقه بیماری در اقوام بیمار، به عنوان عامل خطر اسکیزوفرنیا 33
جدول 4-11، مقایسه فراوانی های ژنوتیپی چندشکلی I/D ژن آنژیوتنسین،
پس از تعدیل ازدواج خویشاوندی والدین بیمار، به عنوان عامل خطر اسکیزوفرنیا 33
جدول 5-1، مقایسه فراوانی های آللی و ژنوتیپی ژن ACE در جمعیت های ایران،
شمال هند، ترکیه، ایتالیا 39
فهرست شکل ها
عنوان صفحه
شکل 3-1- نتایج حاصل از PCR-RFLP بر روی ژل برای ژن XRCC424
شکل 3-2- نتایج حاصل از PCR-RFLP بر روی ژل برای ژن ACE24
فصل اول
مقدمه
1-1- اسکیزوفرنیا
اسکیزوفرنیا (روان گسیختگی) سندرومی بالینی شامل آسیب های روانی متغیر اما عمیقاً ویرانگری است که شناخت، هیجان1، ادراک و سایر جنبه های رفتار را درگیر می کند. بروز این تظاهر در افراد مختلف و در طول زمان متغیر است اما تأثیر بیماری همواره شدید و معمولا دیرپا2 است. اسکیزوفرنیا معمولاً قبل از 25 سالگی شروع می شود و تا آخر عمر پایدار می ماند و هیچ یک از طبقات اجتماعی از ابتلای به آن مصون نیستند. بلویلر3 اصطلاح اسکیزوفرنیا را وضع کرده است تا مبیّن گسیختگی4هایی باشد که میان فکر، احساس، و رفتار بیماران مبتلا به این اختلال وجود دارد (کاپلان، 1378).
یک درصد جمعیت جهان، به اختلال اسکیزوفرنی دچار هستند و معمولا گزارش می شود که به طور مساوی بر جنس زن و مرد تاثیر گذار است (هر چند بحث در مورد خطر بیشتر برای مردان وجود دارد (Aleman et al., 2003).
میزان بروز سالیانه اسکیزوفرنی از 5/0 تا 5 در صد در هر 10000 نفر متغیر است و این میزان در نواحی جغرافیایی مختلف نیز یکسان نیست. مثلاً، میزان بروز اسکیزوفرنی در افرادی که در نواحی شهری جوامع صنعتی به دنیا آمده اند بیشتر است (کاپلان، 1378).
1-1-2- علائم اسکیزوفرنیا
– نشانه های مثبت5: رفتارهای عجیبی هستندکه به رفتارهای عادی فرد بیمار افزوده می شوند و شامل هذیان ها6، تفکر و گفتار از هم گسیخته، توهم7 و رفتارهای عجیب و غریب8می باشند.
انواع هذیان:
هذیان گزند و آسیب9: فرد مبتلا تصور می کند دیگران می خواهند به او آسیب برسانند.
هذیان عظمت (بزرگ منشی)10: به عنوان مثال فرد مبتلاء تصور می کند ناپلئون است.
هذیان کنترل: فرد مبتلاء تصور می کند دیگران افکار او را کنترل می کنند.
هذیان تنی (بدنی، جسمی)11: فرد تصور می کند فکر و ذهنش پاره می شود.
توهم: در بیماران مبتلا به اسکیزوفرنی، هر یک از پنج حس ممکن است دچار حالات توهمی گردد. اما شایع ترین توهم ها، توهم های شنوایی است. این صداها اغلب به تهدید، اهانت، اتهام یا فحاشی می پردازند. ممکن است دو یا چند صدا باشند که با هم به گفتگو می پردازند و یا یک صدا باشد که در مورد زندگی یا رفتار بیمار اظهار نظر می کند. توهم های بینایی هم شایع است، اما توهمهای لمسی، بویایی و چشایی معمول نیست.
– نشانه های منفی12: شامل کمبودهایی در شخصیت است و عبارتند از واکنش های سطحی، از دست دادن اراده، گریختن از اجتماع، عدم بروز عواطف13 و عدم لذت14 از زندگی می باشد.
– اختلالات شناختی15: شامل اختلال در توجه، حافظه، تمرکز، یادگیری و حل مساله می باشد. اختلالات شناختی دارای تاثیری منفی بر روی عملکرد های روزانه فرد می باشد (Palmer et al., 1997, Goldberg et al., 1995).
1-1-3-سبب شناسی16 اسکیزوفرنی
بیماری اسکیزوفرنی یک بیماری چند عاملی17 است و نتیجه بر هم کنش فاکتورهای ژنتیکی و محیطی است.
1-1-3-1- عوامل ژنتیکی
در برخی و شاید در تمامی انواع اسکیزوفرنی عوامل ژنتیک دخالت دارند و بخش اعظم استعداد ابتلا به اسکیزوفرنی مربوط به عوامل ژنتیکی است که اثرات افزایشی دارند. احتمال ابتلا به اسکیزوفرنی با میزان قرابت خونی بستگان مبتلا (درجه اول یا درجه دوم) همبستگی دارد. در دوقلوهای یک تخمکی که زمینه ژنتیکی یکسانی دارند میزان همگامی در مورد اسکیزوفرنی حدود 50 درصد است که این میزان چهار یا پنج برابر همگامی دو قلوهای دو تخمکی یا میزان بروز در سایر بستگان درجه اول (خواهر و برادرها، والدین یا فرزندان) است. افت بارز بروز اسکیزوفرنی دربستگان درجه دوم و سوم بیماران نسبت به بستگان درجه اول نیز نقش عوامل ژنتیک را نشان می دهد. با این همه داده های مربوط به دوقلوهای یکسان به طور واضح نشان می دهند افرادی که زمینه ژنتیکی ابتلا به اسکیزوفرنی را دارند الزاماً به این بیماری دچار
نمی شوند و برای بروز این بیماری در افراد دخالت عوامل دیگر (مانند عوامل محیطی) ضروری است (کاپلان، 1378). داده های قدرتمندی وجود دارند که نشان می دهند سن پدر همبستگی مستقیمی با بروز اسکیزوفرنی دارد. مطالعات انجام شده بر روی آن دسته از بیماران اسکیزوفرنی که سابقه بیماری در بستگان پدری یا مادری آنها وجود نداشته است نشان داد افرادی که در زمان تولد سن پدرشان 60 سال یا بالاتر بوده استعداد ابتلا به این اختلال را پیدا می کنند Malaspina et al., 2001),(Zammit et al., 2003. احتمالاً تولید اسپرم در مردان مسن بیش از مردان جوان در معرض آسیب اپی ژنتیک قرار دارد (Malaspina et al., 2002).
مدل های انتقال ژنتیکی اسکیزوفرنی معلوم نیست اما به نظر می رسد چندین ژن در استعداد ابتلا به اسکیزوفرنی نقش دارند. مطالعات ژنتیکی پیوستگی و ارتباط شواهد قوی به نفع 9 مکان پیوستگی ارائه کرده اند:1q، 5q، 6p، 6q، 8p، 10p، 13q، 15q،22q
Straub et al., 2001, Levinson et al., 2003),Badner and Gershon.2002).
تحلیل بیشتر این مکان های کروموزومی به شناسایی ژن های اختصاصی احتمالی منجر شده است و بهترین ژن های احتمالی مطرح عبارتند از:
– نورگولین1 (NRG1,8p21-p12)
– دیسبیندین (DNTBP1,6p22.3)
– ژن RGS4(1q21-22)
– رسپتور D3دوپامین (DRD3,11q22-23)
– رسپتور 2a سروتونین (5HT2a,13q14-q21)
– ژن های کتکول-o-متیل ترنسفراز (COMT) و پرولین دهیدروژناز (PRODH2) (22q11)
– ژن هایDISC2 , DISC1 (Disrupted-in-Schizophrenia) (1q) (کاپلان، 1378).
1-1-3-2- عوامل بیوشیمیایی
1- فرضیه دوپامینی. ساده ترین شکل فرضیه دوپامینی – اسکیزوفرنی این است که اسکیزوفرنی نتیجه فعالیت بسیار زیاد دوپامینرژیک است.
2- سروتونین. طبق فرضیات موجود، فزونی سروتونین یکی از علل علایم مثبت و منفی اسکیزوفرنی است.
3- گابا. انتقال دهنده عصبی گابا یک اسید آمینه مهاری است و در پاتوفیزیولوژی اسکیزوفرنی دخالت دارد.
4- نوروپپتیدها.
5- گلوتامات.
6- استیل کولین ونیکوتین.
7- نوراپی نفرین.
1-1-3-3- عوامل محیطی
1-سن و جنس. شیوع اسکیزوفرنی در مردان و زنان مساوی است ولی شروع و سیر بیماری در دو جنس تفاوت دارد. اسکیزوفرنی در مردها زودتر از زن ها شروع می شود. شایع ترین سن شروع در مردها 25-10 و در زنان 35-25 سالگی است. شروع اسکیزوفرنی قبل از ده سالگی یا بعد از شصت سالگی بی نهایت نادر است. برخی مطالعات نشان داده است که مردان بیشتر از زنان ممکن است دچار علایم منفی شوند و زن ها بیشتر از مردان ممکن است قبل از شروع بیماری کارکرد اجتماعی بهتری داشته باشند. در کل فرجام بیماران مونث بهتر از بیماران مذکر است ( Rasanen et al., 2000,Jablensky et al., 1992 , کاپلان,1378(.
2- مشکلات مربوط به زایمان18(Cannon et al., 2002).
3- فصل تولد19. افرادی که دچار اسکیزوفرنی می شوند، بیشتر در اوایل زمستان و اوایل بهار متولد شده اند. برای توضیح این مشاهده، فرضیه های گوناگونی را ارائه کرده اند. از جمله این فرضیه که نوعی عوامل خطرساز مختص این فصل ها نظیر ویروس یا تغییر فصلی برنامه غذایی وجود دارد. فرضیه دیگر این است که افرادی که استعداد ابتلا به اسکیزوفرنی را دارند از برتری زیستی بیشتری برای بقا در برابر صدمات مختص این فصل ها برخوردارند (1378، کاپلان، Torrey et al., 1997, Tochigi et al., 2004).
4- مهاجرت20. شیوع بیشتر اسکیزوفرنی در میان تازه مهاجران دیده شده است و این یافته به معنای آن است که تغییر ناگهانی فرهنگی به شکل یک عامل فشار در ایجاد اسکیزوفرنی دخالت دارد (1378، کاپلان، Hutchinson and Haasen, 2004).
5- سوء مصرف مواد. سوء مصرف مواد در اسکیزوفرنی شایع است. سوء مصرف مواد (به جز توتون) با کارکرد ضعیف تر بیمار همراه است. شیوع مصرف الکل در طول عمر بیماران دچار اسکیزوفرنی 40 درصد گزارش شده است. سوء مصرف الکل خطر بستری شدن را افزایش داده و در برخی بیماران ممکن است سبب افزایش علایم روانپریشی (سایکوتیک)21 شود. توجه خاصی به ارتباط مصرف حشیش22 و اسکیزوفرنی جلب شده است (کاپلان، 1378) مصرف زیاد حشیش (بیش از 50 دفعه) خطر بروز اسکیزوفرنی را در مقایسه با کسانی که مصرف نمی کنند شش برابر افزایش می دهد (Arseneault et al., 2004).
6- تراکم جمعیت. در شهرهایی که بیش از یک ملیون نفر سکنه دارند بین شیوع اسکیزوفرنی و تراکم جمعیت منطقه، همبستگی دیده شده است. میزان بروز اسکیزوفرنی در فرزندان والدینی که یک یا هر دوی آنها مبتلا به اسکیزوفرنی هستند، در جوامع شهری دو برابر جوامع روستایی است. مشاهدات مذکور همه حاکی از آن است که فشارهای اجتماعی محیط های شهری می تواند بر وقوع اسکیزوفرنی در کسانی که در معرض خطرند اثر بگذارد (Pedersen and Mortensen, 2001).
1-1-3-4- آسیب شناسی عصبی
پژوهشگران در انتهای قرن بیستم در کشف مبنای احتمالی آسیب شناسی عصبی اسکیزوفرنی به جهش های چشم گیری نائل شدند. این مبنا در درجه اول در دستگاه لیمبیک23 و عقده های قاعده ای قرار دارد و شامل نابهنجاری هایی از نظر آسیب شناسی عصبی یا شیمی عصبی در قشر مخ، تالاموس و ساقه مغز است.
کاهش حجم مغز که در بیماران اسکیزوفرنی به فراوانی گزارش شده است، ظاهراً نتیجه کاهش تراکم آکسون ها، دندریت ها و سیناپس ها است که واسطه انجام کارکردهای ارتباطی و تداعی ها در مغزند.
تراکم سیناپسی در یک سالگی از هر زمان دیگری بیشتر است، سپس تقلیل می یابد و در اوایل نوجوانی به حد بزرگسالی می رسد. مشاهده شده است که بیماران اغلب در نوجوانی دچار علائم اسکیزوفرنی می شوند. بر طبق نظریه ای که تا حدودی مبتنی بر این مشاهده است، اسکیزوفرنی در نتیجه هرس شدن مفرط سیناپس ها در این مرحله از رشد پیدا می شود (کاپلان، 1378).
1-1-4- انواع اسکیزوفرنیا
1-نوع بدگمان (پارانوئید)24. اشتغال خاطر به یک یا چند هذیان یا داشتن توهم های مکرر شنوایی مشخصه این نوع اسکیزوفرنی است. به طور سنتی این نوع اسکیزوفرنی عمدتاً با هذیان های گزند یا خود بزرگ بینی مشخص می شود.
2-نوع نابسامان25. مشخصه های این نوع اسکیزوفرنی که سابقاً کودک روانی (هبفرنی) خوانده می شد عبارت است از پسرفت آشکار به رفتارهای بدوی، مهارگسیخته و سازمان نیافته است. شروع این نوع از اسکیزوفرنیا معمولاً زود یعنی قبل از بیست و پنج سالگی است.
3- نوع کاتاتونیک26. این نوع اسکیزوفرن چندین دهه پیش شایع بود و امروزه در اروپا و آمریکا شمالی نادر است. خصیصه اصلی این نوع اسکیزوفرنی شامل آشفتگی واضح در کارکرد حرکتی است که ممکن است شامل بهت، منفی کاری، سفتی عضلات، بر آشفتگی یا اتخاذ وضعیت های خاص بدنی است.
4-نوع نامتمایز27. غالباً بیمارانی را که به وضوح مبتلا به اسکیزوفرنی اند نمی شود به راحتی در یکی از انواع ذکر شده گنجاند. این بیماران را تحت عنوان مبتلایان به اسکیزوفرنی از نوع نامتمایز دسته بندی می کنند.
5- نوع باقی مانده28. وجود مداوم شواهد اختلالی از نوع اسکیزوفرنی، در غیاب مجموعه کامل علایم مرحله فعال یا علایمی که برای تشخیص نوع دیگری از اسکیزوفرنی کافی باشد، مشخصه نوع باقی مانده است (کاپلان، 1378).
1-1-5- درمان اسکیزوفرنیا
اگرچه داروهای ضد روانپریشی29 تکیه گاه اصلی درمان اسکیزوفرنی به شمار می روند، در پژوهش ها معلوم شده که مداخله های روانی- اجتماعی، از جمله روان درمانی می توانند بهبود بالینی را تقویت کنند. پیچیدگی اسکیزوفرنی سبب می شود هیچ رویکرد درمانی به تنهایی برای مقابله با این اختلال چند وجهی کفایت نکند. برای اکثر بیماران مبتلاء به اسکیزوفرنی، کاربرد ترکیبی از ضد روان پریشی ها و درمان های روانی- اجتماعی، سودمندتر از کاربرد هریک از این درمان ها به تنهایی خواهد بود (Bustillo et al., 2001).
داروهایی که در درمان اسکیزوفرنی به کار می روند خواص دارویی بسیار متنوعی دارند، اما وجه مشترک همه آنها آنتاگونیسم30 بودن برای گیرنده های دوپامینی پس سیناپسی در مغز است. این داروها را می توان به دو گروه عمده تقسیم کرد: 1- داروهای ضد روان پریشی متعارف قدیمی که داروهای ضد روان پریشی نسل اول یا آنتاگونیسم های گیرنده دوپامین نیز نامیده می شوند و 2- داروهای جدیدتر که داروهای ضد روان پریشی نسل دوم یا آنتاگونیسم های سروتونین – دوپامین نامیده می شوند (کاپلان، 1378).
متاسفانه داروهای ضدروانی دارای عوارض جانبی ناخوشایند از جمله افزایش وزن، خشکی دهان و یبوست می باشند. بر طبق مطالعات انجام شده مصرف طولانی مدت این داروها همراه با افزایش تولید رادیکال های آزاد می باشد (1376، هاریسون ،McGorry and Yung, 2003).
1-2- ژن ترمیمی XRCC4
آسیب به مولکولDNA به طرق مختلف می تواند به وجود آید. آسیب به DNA می تواند به صورت شکست های خود به خودی در پیوندهای شیمیایی این مولکول یا به وسیله عوامل محیطی از قبیل پرتوهای فرابنفش و پرتوهای یونی و یا به وسیله واکنش با ترکیبات شیمیایی ژئوتوکسیک که به طور طبیعی در متابولیسم سلولی تولید شده و یا در محیط وجود دارند به وجود آید.
جلوگیری از وقوع اشتباه در توالیDNA در سلول های مختلف برای حیات ضروری می باشد. در نتیجه سلول برای تعمیر DNA آسیب دیده و تصحیح اشتباه در توالی، چندین مکانیسم ترمیمی را در خود به وجود آورده است. در واقع مکانیسم های ترمیمی DNA باعث حفظ آن در برابر آسیب های درون زاد31 و برون زاد32 می شوند Kiyohara et al., 2006), Lindahl,1995,(Wood et al., 2005.
به طور قابل توجهی نقص در مکانیسم های ترمیم DNA با به وجود آمدن سرطان رابطه خیلی نزدیکی دارند. وقتی که مکانیسم های ترمیمی، جهش را از بین نبرد این جهش ها در سلول جمع می شوند. اگر این جهش ها ژن هایی که در تنظیم تقسیم سلولی شرکت می کنند را تحت تاثیر قرار دهند منجر به تولید تومور و در پی آن سرطان می شوند (1378، رابینز، Lewin, 1999).
اشعه های یونیزان (مثل تابش ایکس و گاما) و برخی داروهای ضد سرطان باعث ایجاد شکست های دو رشته ای در مولکول DNA می شوند. این شکست ها باعث آسیب های جدی در مولکول DNA می شوند زیرا اتصال مجدد قطعه جدا شده به بقیه DNA اگر اشتباه صورت بگیرد می تواند منجر به از بین رفتن ترتیب صحیح کروموزومی و عمل کرد ژن ها شود. به عنوان مثال، اتصال اشتباه می تواند باعث ایجاد یک ژن هیبرید شود و یا پروموتر یک ژن نزدیک ناحیه کد کننده ژن دیگر قرار گیرد و در نتیجه سطح بیان آن ژن را تغییر دهد.
دو مکانیسم برای ترمیم شکست های دو رشته ای وجود دارد. در واقع مکانیسم غالب برای ترمیم چنین شکست هایی در جانداران پر سلولی اتصال انتهای غیر همولوگ (NHEJ)33 می باشد. مکانیسم دوم برای ترمیم چنین شکست هایی، نوترکیبی همولوگ می باشد34.
انواعی از ژن های ترمیمی در ژنوم انسان وجود دارند از جمله ژن 35XRCC4 که دارای نقش مهمی در مسیر ترمیمی NHEJ است (Chiu et al., 2008b). ژن XRCC4 روی کروموزوم 5q14.2 قرار دارد. پروتئین کد شونده توسط این ژن دارای 336 اسید آمینه است که در واقع درون 8 اگزون قرار دارد (Wang et al., 2010).
XRCC4 دارای یک دمین هلیکالی بلند است که مسئول برهم کنش با DNA لیگاز4
می باشد به علاوه این پروتئین به عنوان یک کمند انعطاف پذیر بین KU70وKU80 عمل
می کند. XRCC4به وسیله تشکیل کمپلکس با DNA لیگاز4 و پروتئین کیناز وابسته به DNA در ترمیم شکست های دورشته ای DNA به وسیله مسیر ترمیمیNHEJ دخاالت
می کند .(Chang et al., 2009)
با توجه به مطالعاتی که بر روی مدل های حیوانی انجام شد، موش هایی که در آن ها ژن XRCC4 غیر فعال بود فاقد عمل کردی نرمال در تمایز لنفوسیت ها و نرون ها بودند که در نتیجه منجر به کشندگی جنینی می شد (Chang et al., 2008). چند شکلی نوکلئوتیدی36 (SNP) حاصل یک جایگزینی بازی است. SNPدر ناحیه کدکننده پروتئین باعث دو نوع موتاسیون از نوع missense (synonymous) و nonsense (nonsynonymous) می شود به علاوه SNP در منطقه پروموتر باعث افزایش یا کاهش بیان ژن می شود در حالی که SNP در منطقه اینترون ژن باعث نقص در پردازش یا تغییر در سرعت رونویسی می شود .(Hsieh et al., 2008) انواعی ازSNP در ژن XRCC4 شناسایی شده است یکی از آن ها حذف و اضافه موجود در اینترون 3 این ژن می باشد.
3-1- ژن آنژیوتنسین
سیستم رنین- آنژیوتنسین دارای دو نقش مهم در تنظیم فشار خون و کارکرد کلیه ها می باشد
.(Akman et al., 2009) جایگاه اصلی این سیستم در دیواره رگ ها می باشد و دارای دو نقش مهم در کنترل انقباض رگ ها و هم چنین کنترل فرآیند التهاب از طریق کاهش تولید سیتوکین ها37 می باشد.(Karakus et al., 2013) ACE یک آنزیم کلیدی در سیستم
رنین- آنژیوتنسین می باشد. این آنزیم یک دی پپتیدیل کربوکسی پپتیداز است که با برداشتن یک دی پپتید از C ترمینال، آنژیوتنسین I غیرفعال آن را به آنژیوتنسینII فعال به فرم اکتاپپتید تبدیل می کند. علاوه بر این ACE برادی کینین های ملتهب کننده عروق را از طریق سیستم kallikrein-kininogen کاهش می دهد. به علاوه مطالعات حیوانی نشان داد که ACE تبدیل دوپامین در مغز میانی را تنظیم می کند (Raza et al., 2013).
ACE یک آنزیم خارج سلولی است که برروی غشاء پلاسمایی38 انواع مختلفی از سلول ها از جمله سلول های آندوتلیال دیواره رگ ها، سلول های لوله های پروکسیمال رنال و هم چنین در سلول های اپیتلیال موجود درمغز و مایع های بیولوژیکی از جمله پلاسما و مایع
مغزی-نخاعی موجود می باشد .ژن کد کننده ACE روی بازوی بزرگ کروموزوم 17 (17q 23) قرار دارد. این ژن 21 کیلو باز طول دارد و شامل 26 اگزون و 25 اینترون می باشد (Subbiah et al., 2011).
چندین مطالعه نشان داد که پلی مورفیسم های ژن ACE بر روی قابلیت ابتلاءپذیری فرد به تعدادی از بیماری ها از جمله فشار خون39، بیماری های قلبی40 و دیابت تیپ دو اثر دارند.(Yang et al., 2013) ژن ACE دارای انواعی از پلی مورفیسم ها می باشد از جمله پلی مورفیسم حذف و اضافه توالی تکراری 287 ALU که در انتهای´3 اینترون 16 واقع می باشد. در واقع این پلی مورفیسم به طور قوی با میزانACE موجود در سلول و پلاسما مرتبط است و نشان داده شده که این پلی مورفیسم ممکن است بیان ژن ACE را تنظیم کند
(Markus et al., 1995).
4-1-هدف
با توجه به این که XRCC4 یکی از ژن های مهم در مسیر ترمیم DNAدو رشته ای آسیب دیده است تا به حال مطالعات زیادی ارتباط بین چند شکلی های این ژن و بیماری های مختلف از جمله سرطان را برسی کرده اند. هم چنین با توجه به نقش ژن آنژیوتنسین در تنظیم تبدیل دوپامین در مغز میانی مطالعات زیادی به بررسی ارتباط این ژن با بیماری اسکیزوفرنیا پرداخته اند. هم چنین با توجه به گزارشات رسیده در زمینه تاثیر منفی بیماری های روانی بر کیفیت زندگی افراد مبتلا، قصد داریم مطالعه ای با هدف برسی ارتباط بین چند شکلی I/Dواقع در اینترون 3 ژنXRCC4 و اینترون 16 ژن آنژیوتنسین و خطر ابتلاء به اسکیزوفرنیا انجام دهیم.
فصل دوم
مروری بر تحقیقات گذشته
1-2- مطالعات زیست شناختی اسکیزوفرنیا
اسکیزوفرنی یک بیماری چند عاملی محسوب می شودکه هر دو عامل ژنتیک و محیط در بروز آن نقش دارند. چندین مطالعه ژنوم اسکن41 ارتباط بین نواحی مختلف کروموزومی و بیماری اسکیزوفرنی را نشان می دهند. مطالعات linkage disequilibrium بر روی این نواحی چندین ژن را با این بیماری مرتبط می دانند (Zakharyan et al., 2011). مطالعات زیادی ارتباط بین نواحی مختلف کروموزومی و بیماری اسکیزوفرنی را مورد برسی قرار داده اند.
2-2- مطالعات انجام شده در رابطه با XRCC4
مولکول DNA، مخزن اطلاعات وراثتی و دستورالعملی برای عملکرد صحیح ارگانیسم می باشد و در واقع آسیب به این مولکول تهدید جدی برای پایداری ژنتیکی است. در ژنوم انسان تعدادی از ژن ها از جمله XRCC4درگیر در مسیرهای ترمیم DNA می باشند. در واقع افرادی که با ناهنجاری های وراثتی در ژن های ترمیم کننده DNA متولد می شوند در معرض خطر بیشتری برای ابتلا به انواع سرطان ها قرار دارند Kiyohara et al., 2006), Lindahl,1995,(Wood et al., 2005. چندین مطالعه به برسی ارتباط بین پلی مورفیسم حذف و اضافه موجود در اینترون 3 ژن XRCC4 و انواعی از سرطان ها پرداخته اند. بر اساس پژوهشی که در سال 2008 در تایوان انجام شد بین پلی مورفیسم (G 1394 T) ژن XRCC4 و سرطان سینه ارتباط معناداری وجود دارد و در واقع احتمال ابتلا به این سرطان در افراد با ژنوتیپ T/Tو 2.33 G/T برابر بیشتر از افراد با ژنوتیپG/G است. (Chiu et al., 2008b). چندین مطالعه به طور جداگانه در سالهای 2008 و 2009 در تایوان به بررسی ارتباط بین پلی مورفیسم حذف و اضافه در اینترون سه ژن XRCC4 و سرطان های پروستات، معده و مثانه پرداخته اند و ارتباط معنادار مشاهده نشد Chang et al., 2008), Hsieh et al., 2008, (Chang et al., 2009.
در سال 2007 در تایوان پژوهشی به منظور بررسی ارتباط بین پلی مورفیسم حذف و اضافه در اینترون سه ژن XRCC4 و سرطان دهان انجام شد و بر اساس این پژوهش احتمال ابتلا به این سرطان در افراد با ژنوتیپ I/D57/1 برابر بیشتر از افراد با ژنوتیپ I/I است
(Tseng et al., 2008). مطالعه دیگری در تایوان به برسی ارتباط بین پلی مورفیسم حذف و اضافه در اینترون 3 ژن XRCC4 و احتمال ابتلا اطفال به لوکمیا پرداخت و بر اساس این پژوهش آلل D عامل خطری برای این بیماری محسوب می شود (Wu et al., 2010). بر اساس مطالعه ای که در شمال هند به برسی ارتباط بین پلی مورفیسم حذف و اضافه ژنXRCC4 و سرطان پروستات پرداخت ژنوتیپ D/D احتمال ابتلا به این سرطان را افزایش می دهد (Mandal et al., 2011).
2-3 مطالعات انجام شده در مورد ژن آنژیوتنسین
مطالعات زیادی به برسی ارتباط بین پلی مورفیسم حذف و اضافه موجود در اینترون 16 ژن آنژیوتنسین و انواعی از بیماری های روانی از جمله اسکیزوفرنیا پرداخته اند. براساس مطالعاتی که جداگانه در دو کشور ترکیه و هند انجام شد ارتباط معناداری بین پلی مورفیسم حذف و اضافه ژن آنژیوتنسین و بیماری اسکیزوفرنیا وجود دارد. نتایج حاصل از این مطالعات شیوع پایینی از آلل I را در بیماران اسکیزوفرنیا نشان داد و بر این اساس آلل I می تواند عاملی محافظت کننده بر علیه اسکیزوفرنیا باشد. هم چنین بر اساس این مطالعات یک وابستگی مثبت بین ژنوتیپ D/D و میزان ACE موجود در سرم وجود دارد و سطح این آنزیم به طور معناداری در افراد اسکیزوفرن با ژنوتیپ D/D در مقایسه با ژنوتیپ I/D وI/I بیشتر است Kucukali et al., 2010)).
بر خلاف دو مطالعه بالا بر اساس مطالعه ای که در کشور اسپانیا انجام شد آلل D به عنوان یک عامل محافظت کننده در برابر اسکیزوفرنیا می باشد و بر اساس همین مطالعه آلل D خطر ابتلا به اسکیزوفرنیا را تا 50 درصد کاهش می دهد (Crescenti et al., 2009). بر اساس مطالعاتی که در کشورهای ترکیه، فلسطین اشغالی و تایوان انجام شد هیچ ارتباط معناداری بین پلی مورفیسم حذف و اضافه ژن آنژیوتنسین و بیماری اسکیزوفرنیا وجود ندارد
Baskan et al., 2010), Segman et al., 2002, .(Ouyang et al., 2001
بر اساس مطالعه انجام شده در کشور کره جنوبی ارتباط معناداری بین ژن آنژیوتنسین و بیماری اسکیزوفرنی وجود ندارد اما بر اساس همین مطالعه بین تعداد آلل D در افراد اسکیزوفرنی و افزایش شدت نشانه های اسکیزوفرنی ارتباط معناداری وجود دارد.
(Nadalin et al., 2012).
بر اساس مطالعه ای در ژاپن ارتباط معناداری بین پلی مورفیسم حذف و اضافه، ژن آنژیوتنسین و Polydipsia/Water intoxication در بیماران اسکیزوفرنیا وجود دارد. نتایج حاصل از این مطالعه نشان داد که آلل D ممکن است یک فاکتور خطر برای Polydipsia/Water intoxication در بیماران اسکیزوفرنی باشد(Shinkai et al., 2003).
2-4- فرضیات
در این پژوهش ها فرض بر این است که:
1- ژنوتیپ D/D متعلق به چند شکلی Insertion/Deletionاینترون 3 ژن XRCC4، در مقایسه با ژنوتیپ I/I این ژن احتمال ابتلا به اسکیزوفرن را افزایش می دهد.
2- ژنوتیپ D/D در مقایسه با ژنوتیپ I/I در چند شکلی Insertion/Deletion اینترون 16 ژن آنژیوتنسین، خطر ابتلا به اسکیزوفرن را افزایش می دهد.
فصل سوم

وسایل، مواد و روش ها
3-1- نمونه گیري
363 فرد مبتلا به اسکیزوفرنیا با میانگین سنی 13± 5/41، به صورت تصادفی از بیمارستان
ابن سینا و بیمارستان اعصاب و روان رازی در شهر شیراز انتخاب شدند. از میان مراجعه کنندگان به مرکز انتقال خون (بدون سابقه روانی) 363 نفر با میانگین سنی 1/11±7/39 به عنوان گروه کنترل انتخاب شدند. از هر فرد شرکت کننده در این مطالعه 5/1 میلی لیتر خون گرفته شد و در لوله های حاوی EDTA و شرایط دمایی 4 درجه سانتی گراد به آزمایشگاه آورده شد.
اطلاعات مورد نیاز از افراد شرکت کننده در این مطالعه از طریق پرسشنامه ای که توسط هر فرد تکمیل گردید به دست آمد.
3-2- وسایل مورد نیاز
• سمپلر (Socorex و Brand)
• تانک الکتروفورز (پایا پژوهش)
• ترازو
• میکروسانتریفیوژ (Hettich)
• Vortex (Scientific industries INC)
• مایکروویو (بوتان)
• ترموسایکلر (Techne)
• Rotator (پدیده نوژن پارس)
• PH meter (Metrohm)
• Hot plate (Techne)
• دستگاه Gel documentation (Uvitec Cambridge)
• Heater
• Incubator
• اتوکلاو (ریحان طب)
3-3- مواد مورد نیاز
• محلول NH4Cl (170 میلی مولار)
• NaCl-EDTA (10 میلی مولار)
• NaOH (50 میلی مولار)
• Tris HCl (1مولار)
• پرایمرهای رفت و برگشت ژن XRCC4 و آنژیوتنسین (سیناژن)
• بافر X10 مخصوص PCR (سیناژن)
• MgCl2 (سیناژن)
• dNTPs (سیناژن)
• Taq DNA polymerase(سیناژن)
• بافر TBE (X 5/.)
• محلول اتیدیوم بروماید (X 1000)
• loading Buffer 6X(سیناژن)
• Agarose (Invitrogen)
• DNA Ladderbp100 (Vivantis)
• Buffer G (Fermentas)
• Boric acid (Merck)
• EDTA (Merck)
• Tris Base (سیناژن)
3-4- تهیه محلول ها
محلول های مورد نیاز در این مطالعه با روش های معین تهیه شده اند (راضیه اجتهادی,1392).
3-5- استخراج DNA از خون محیطی به روش جوشاندن ((Boiling
استخراج DNA به روش جوشاندن (Boiling) در آزمایشگاه انجام شد (راضیه اجتهادی ,1392).
3-6- واکنش زنجیره‌ای پلیمراز (PCR)42
کلیه مواد لازم جهت تهیه مخلوط PCR به جز آنزیم Taq باید ذوب و ورتکس گردند. مخلوط PCR را طبق جدول 3-1 تهیه می کنیم. به هر تیوپ مخلوط PCR و DNA template اضافه می گردد و سپس تیوپ ها را در دستگاه PCR با برنامه ارائه شده در جدول 3-2 قرار
می دهیم.
جدول 3-1- مواد مورد نیاز برای تهیه مخلوط واکنش PCR
اجزای واکنشحجم مورد نیاز به ازای هر واکنش (میکرولیتر)غلظت نهایی (میکرولیتر)X buffer105/2X1(mM10)dNTP5/0mM2/0(mM 50) MgCl275/0mM 5/1پرایمر رفت 1pmol 4/0پرایمر برگشت 1pmol 4/0Taq DNA polymerase
(u/ml 5)3/0u/µl06/0آب استریل95/13DNA استخراج شده5
3-7- تعیین ژنوتیپ ژن XRCC4
جهت تعیین ژنوتیپ موجود در اینترون شماره 3 ژن XRCC4 از پرایمرهای زیر استفاده شد (Chiu et al., 2008a).
Forward: 5′-TCCTGTTACCATTTCAGTGTTAT -3′
Reverse: 5′-CACCTGTGTTCAATTCCAGCTT -3′
جدول 3-2- برنامه تنظیم شده برای واکنش PCR جهت تکثیر ژن XRCC4
مرحلهدمازماندناتوراسیون اولیه43C˚945 دقیقهدناتوراسیون44C˚9430 ثانیه35سیکلاتصال45C˚5530 ثانیهطویل شدن46C˚7230ثانیهبسط نهایی47C˚7210 دقیقهبعد از PCR بلافاصله الکتروفورز می نمائیم. باند‌های حاصل از چند ‌شکلی دارای الگویی مطابق با جدول 3-3 می باشد.
جدول 3-3- باندهای حاصل از PCR در ژنوتیپ های XRCC4
ژنوتیپباندها (جفت باز)II139ID109،139DD109
3-8- تعیین ژنوتیپ ژنآنژیوتنسین
جهت تعیین ژنوتیپ موجود در اینترون شماره 16 ژن آنژیوتنسین توالی پرایمری زیر استفاده شد .(Subbiah et al., 2011)
Forward: 5’CTGGAGACCACTCCCATCCTTTCT3
Reverse: 5’GATGTGGCCATCACATTCGTCAGAT3
برنامه PCR، جهت تکثیر الگوی مورد نظر برای این ژن در جدول 3-4 آمده است:
جدول 3-4- برنامه تنظیم شده برای واکنش PCR جهت تکثیر ژن آنژیوتنسین
مرحلهدمازماندناتوراسیون اولیهC˚945 دقیقهدناتوراسیونC˚9430 ثانیه30 سیکلاتصالC˚6430 ثانیهطویل شدنC˚7230 ثانیهبسط نهاییC˚725 دقیقه
بعد از PCR بلافاصله الکتروفورز می نمائیم. باند‌های حاصل از چند‌شکلی دارای الگویی مطابق با جدول 3-5 تعیین گردید.
جدول 3-5- باندهای حاصل از PCR، ژنوتیپ های آنژیوتنسین
ژنوتیپباندها (جفت باز)II490ID190،490DD190
3-9- الکتروفورز
جهت تعیین الگوی چند‌شکلی های مورد مطالعه در ژن های XRCC4 و آنژیوتنسین، الکتروفورز بر روی ژل آگارز 5/1 درصد با استفاده از بافرTBE انجام گرفت. بدین منظور، بسته به حجم سینی ژل مورد استفاده، مقدار مورد نیاز آگارز جهت تهیه ژل 5/1 درصد محاسبه و در حجم مناسب از بافر حل می شود. ظرف حاوی بافر و پودر آگارز تا زمانی که پودر به طور کامل در بافر TBEحل گردد و محلول شفافی بدست آید، در دستگاه مایکروویو قرار می گیرد. زمانی که دمای محلول به حدود 50 تا 60 درجه سانتی گراد رسید در سینی ژل ریخته و شانه‌ی ژل درون آگارز مذاب قرار داده می شود.
پس از حدود 20 تا 30 دقیقه و سرد شدن کامل ژل شانه به آرامی از ژل خارج شده و سینی ژل در درون تانک الکتروفورز حاوی بافر TBE قرار می دهیم به طوری که محلول کاملاً روی چاهک‌های ژل را بپوشاند. سپس محصولات حاصل از PCR ژن های XRCC4 و آنژیوتنسین، توسط سمپلر، پس از مخلوط شدن با مقدار مناسب از بافر6x Loading dye درون چاهک‌ها ریخته و به منظور ارزیابی اندازه قطعات، در یکی از چاهک‌ها100bp DNA Ladder ریخته و سپس دستگاه الکتروفورز به منبع تغذیه‌ی جریان الکتریکی متصل و بر روی ولتاژ و آمپر مناسب تنظیم می شد.
3-10- رنگ‌ آمیزی ژل
پس از پایان الکتروفورز جهت قابل رویت شدن قطعات DNA توسط نور UV، ژل آگارز در محلول TBE حاوی اتیدیوم بروماید (mg/ml1) قرار گرفت و پس از حدود 10 دقیقه رنگ آمیزی، ژل به دستگاهGel Documentation منتقل گردیده و از آن عکسبرداری صورت گرفت.
شکل 3-1- نتایج حاصل از PCR بر روی ژل برای ژن XRCC4
شکل 3-2- نتایج حاصل از PCR بر روی ژل برای ژن ACE
3-11- تحلیل آماری
نتایج حاصل از این مطالعه با استفاده از نرم افزار آماری SPSS و به کار‌گیری روش های مربع کای (χ2) و رگرسیون لجستیک، با در نظر گرفتن سطح معنی داری 05/0>P، مورد تجزیه و تحلیل قرار گرفت.
فصل چهارم
نتایج
4-1- مشخصات افراد شرکت کننده در مطالعه
در این مطالعه مورد-شاهدی چندشکلی های ژنتیکی Insertion/Deletion واقع در اینترون 3 ژن XRCC4 و اینترون 16 ژن آنژیوتنسین در 726 نفر (363 بیمار مبتلا به اختلال اسکیزوفرنی و 363 فرد سالم از جمعیت عمومی به عنوان گروه شاهد) مورد بررسی قرار گرفت. میانگین سن افراد بیمار 1/11±7/39 و افراد سالم 13±5/41 می باشد. اختلاف معناداری بین میانگین سنی افراد سالم و بیمار وجود ندارد (t=1.944, df=674, P=0.052) همچنین میانگین سن بروز اسکیزوفرنی در 245 بیماری که اطلاعات سن بروز برای آنها ذکر شده بود 68/8±2/24 می باشد.
4-2- نتایج حاصل از بررسی عوامل خطر کیفی دخیل در اسکیزوفرنیا
براساس مطالعات انجام شده، احتمال ابتلا به اسکیزوفرنیا در افرادی که در اقوام درجه یک آنها این بیماری وجود دارد 3/14 برابر بیشتر از افرادی است که در اقوام درجه یک آنها این بیماری وجود ندارد. همچنین مصرف سیگار احتمال ابتلا به اسکیزوفرنیا را تقریباً 4 برابر افزایش می دهد. ازدواج خویشاوندی والدین نیز احتمال ابتلا به اسکیزوفرنیا را 5/1 برابر افزایش می دهد (راضیه اجتهادی, 1392).
4-3- نتایج حاصل از بررسی چند شکلی I/Dدر ژن XRCC4
فراوانی های ژنوتیپی و آللی چندشکلی ژنتیکی I/D، ژن XRCC4 در جدول 2-4 آمده است. گروه شاهد برای توزیع چندشکلی I/Dاز تعادل هاردی-واینبرگ پیروی می کند
(χ2=2.04, df=1, P>0.05).
جدول4-2- فراوانی های ژنوتیپی و آللی چندشکلی ژنتیکیI/Dژن XRCC4، در دو گروه شاهد و بیمار
فراوانیسالم (%) Nبیمار (%) NژنوتیپیII(7/26)97(4/28)103ID(4/53)194(1/50)182DD(8/19)72(5/21)78آللیI(4/53)388(4/53)388D(6/46)338(6/46)338
4-3-1- مقایسه فراوانی های ژنوتیپی و آللی بین دو گروه شاهد و بیمار
از آزمون رگرسیون لجستیک جهت مقایسه فراوانی های آللی و ژنوتیپی در دو گروه شاهد و بیمار استفاده شد. همانطورکه در جدول 4-3 ملاحظه می شود هیچ یک از ژنوتیپ ها ارتباط معنی داری با استعداد ابتلا به اسکیزوفرنی ندارند. فراوانی ژنوتیپ D/D در بیماران 5/21 درصد و در افراد سالم 8/19 درصد است که این اختلاف از لحاظ آماری معنی دار نیست
(OR=1.02, 95%CI=0.67-1.56, P =0.926).
فراوانی ژنوتیپ I/D در بیماران 1/50 درصد و در افراد سالم 4/53 درصد است که این اختلاف از لحاظ آماری معنی دار نیست (95%CI=0.63-1.24, P=0.479 OR=0.88,). در اینجا افراد دارای ژنوتیپ I/I به عنوان مبنا در نظر گرفته می شوند.
جدول 4-3- مقایسه فراوانی های ژنوتیپی و آللی چند شکلی I/D ژن XRCC4،
بین دو گروه شاهد و بیمار
OR95% CIPژنوتیپیII1–ID88/024/1-63/0479/0DD02/156/1-67/0926/0ID+DD92/027/1-66/0618/0آللیI1–D123/1-81/01
4-3-2- مقایسه فراوانی های ژنوتیپی چندشکلی I/Dژن XRCC4، بین دو گروه شاهد و بیمار، پس از تعدیل عوامل خطر بیماری اسکیزوفرنیا
در جدول های 4-4 تا 4-6 اثر برخی از عوامل مستقل مورد مطالعه مانند مصرف سیگار، داشتن سابقه خانوادگی، ازدواج خویشاوندی والدین بر استعداد ابتلا به اسکیزوفرنی بررسی شده است.
جدول4-4 مقایسه فراوانی های ژنوتیپی چند شکلی I/DژنXRCC4، پس از تعدیل سیگار به عنوان عامل خطر اسکیزوفرنیا
OR95% CIPژنوتیپII1–ID87/025/1-61/0446/0DD96/051/1-62/0876/0ID+DD88/025/1-63/0485/0
جدول 4-5- مقایسه ی فراوانی های ژنوتیپی چند شکلی I/Dژن XRCC4، پس از تعدیل اثر سابقه بیماری در اقوام بیمار، به عنوان عامل خطر اسکیزوفرنیا
OR95% CIPژنوتیپII1–ID25/197/1-79/0335/0DD15/12-66/0630/0ID+DD21/186/1-78/0394/0
جدول 4-6- مقایسه فراوانی های ژنوتیپی چندشکلی I/D ژن XRCC4، پس از تعدیل اثر ازدواج خویشاوندی والدین بیمار، به عنوان عامل خطر اسکیزوفرنیا
OR95% CIPژنوتیپII1–ID08/160/1-73/0690/0DD13/183/1-70/0603/0ID+DD08/157/1-75/0668/0
همان طور که در جداول 4-4 تا 4-6 مشاهده شد، رابطه معناداری بین ژنوتیپ های چند شکلی I/Dژن XRCC4، قبل و بعد از تعدیل عوامل خطر اسکیزوفرنیا، با خطر ابتلا به اسکیزوفرنیا مشاهده نشد.

4-4- نتایج حاصل از بررسی چند شکلی I/D در ژن آنژیوتنسین
فراوانی های ژنوتیپی و آللی چند شکلی ژنتیکی I/D ژن آنژیوتنسین، در جدول 4-7 آمده است. گروه شاهد برای توزیع چندشکلی I/D از تعادل هاردی- واینبرگ پیروی می کند (χ2=2.28, df=1, P>0.05).
جدول 4-7- فراوانی های ژنوتیپی و آللی چندشکلی ژنتیکی I/Dژن آنژیوتنسین،
در دو گروه شاهد و بیمار
فراوانیسالم (%) Nبیمار (%) NژنوتیپیDD)2/37)135(5/38)140I/D(2/51)186(2/53)193II(6/11)42(3/8)30آللیD(8/62)456(2/65)473I(2/37)270(8/34)253
4-4-1- مقایسه فراوانی های ژنوتیپی و آللی بین دو گروه شاهد و بیمار
از آزمون رگرسیون لجستیک جهت مقایسه فراوانی های آللی و ژنوتیپی در دو گروه شاهد و بیمار استفاده شد. همان طور که در جدول 4-8 ملاحظه می شود هیچ یک از ژنوتیپ ها ارتباط معنی داری با استعداد ابتلا به اسکیزوفرنی ندارند. فراوانی ژنوتیپ I/I در بیماران 3/8 درصد و در افراد سالم 6/11 درصد است که این اختلاف از لحاظ آماری معنی دار نیست (OR=0.69, 95%CI=0.41-1.16, P =0.164). فراوانی ژنوتیپ I/D در بیماران 2/53 درصد و در افراد سالم 2/51 درصد است که این اختلاف از لحاظ آماری معنی دار نیست (OR=1, 95%CI=0.73-1.36, P=0.997). در اینجا افراد دارای ژنوتیپ D/D به عنوان مبنا در نظر گرفته می شوند.
جدول 4-8- مقایسه فراوانی های ژنوتیپی و آللی چند شکلی I/D ژن آنژیوتنسین،
بین دو گروه شاهد و بیمار
OR95% CIPژنوتیپیDD1–ID136/1-73/0997/0II69/016/1-41/0164/0ID+II94/027/1-70/0702/0آللیD1–I90/012/1-73/0353/0
4-4-2- مقایسه فراوانی های ژنوتیپی چندشکلی I/Dژن آنژیوتنسین، بین دو گروه شاهد و بیمار، پس از تعدیل عوامل خطر بیماری اسکیزوفرنیا
در جدول های 4-9تا 4-11 اثر برخی از عوامل مستقل مورد مطالعه مانند مصرف سیگار، داشتن سابقه خانوادگی، ازدواج خویشاوندی والدین بر استعداد ابتلا به اسکیزوفرنی بررسی شده است.
جدول4-9 مقایسه فراوانی های ژنوتیپی چند شکلی I/Dژنآنژیوتنسین، پس از تعدیل سیگار به عنوان عامل خطر اسکیزوفرنیا
OR95% CIPژنوتیپDD1–ID01/141/1-73/0931/0II58/001/1-33/0054/0ID+II93/027/1-68/0648/0
جدول 4-10- مقایسه ی فراوانی های ژنوتیپی چند شکلی I/Dژن آنژیوتنسین، پس از تعدیل اثر سابقه بیماری در اقوام بیمار، به عنوان عامل خطر اسکیزوفرنیا
OR95% CIPژنوتیپDD1–ID22/183/1-82/0328/0II70/040/1-35/0315/0ID+II12/166/1-76/0563/0
جدول 4-11- مقایسه فراوانی های ژنوتیپی چندشکلی I/Dژن آنژیوتنسین، پس از تعدیل اثر ازدواج خویشاوندی والدین بیمار، به عنوان عامل خطر اسکیزوفرنیا
OR95% CIPژنوتیپDD1–ID06/150/1-75/0744/0II77/039/1-43/0383/0ID+II01/141/1-72/0966/0
فصل پنجم
بحث
انجام واکنش های متابولیکی در سلول علاوه بر تولید محصولات اصلی، گونه های فعال اکسیژن48 مثل رادیکال های هیدروکسیل و سوپراکسید را به عنوان محصولات همراه49 تولید
می کند.ROS ایجاد شده درون سلول باید به وسیله آنزیم های آنتی اکسیدانی (سوپراکسیددسموتاز50، گلوتاتیون پراکسیداز51 و کاتالاز52) یا آنتی اکسیدان های غیرآنزیمی (اسید یوریک 53و بیلی روبین54) از سلول حذف شوند در غیر این صورت باعث ایجاد آسیب های جدی در اسیدنوکلئیک، پروتئین و لیپید می شوند Fendri et al., 2005),Mahadik et al., 2006). یکی از انواع آسیب های ایجاد شده توسطROS ، شکست های تک رشته ای در مولکولDNA می باشد که در صورت عدم ترمیم به شکست های دو رشته ای تبدیل شده و منجر به ناپایداری ژنومی و مرگ سلولی می شود (Carrano et al., 1986).
عدم ترمیم آسیب های اکسیداتیو و تجمع آن در سلول های نورونی باعث بروز بیماری های دیجنریتیو (تحلیل نورونی)، از طریق تغییر برنامه رونویسی یا القای مرگ سلولی55 می شود (Rolig and Mckinnon., 2000). میزان بالای ROS در مغز (به دلیل بالا بودن میزان متابولیسم هوازی و دفای آنتی اکسیدانی نسبتاً ضعیف در این اندام) و همچنین عدم وقوع ترمیم موثر در نورون های آسیب دیده (به دلیل تمایز یافته و غیرقابل تقسیم بودن این سلول ها) باعث می شوند مغز نسبت به سایر بافت ها در برابر آسیب های اکسیداتیو حساس تر باشد .(Mahadik et al., 2001) در واقع فاکتورهای ژنتیکی (مانند دفاع ضعیف آنزیم های آنتی اکسیدانی) و فاکتورهای غیرژنتیکی (مانند عفونت های دوره جنینی و طفولیت، سوء تغذیه مادر، سوء مصرف الکل، سیگار و داروهای مخدر، جنسیت، فصل تولد) باعث تولید ROS بیشتر و در نتیجه وقوع بیشتر آسیب های سلولی اکسیداتیو در افراد اسکیزوفرنی
می شوند.(Mahadik et al., 2006) بالا بودن میزان آسیب های اکسیداتیو در افراد اسکیزوفرنی باعث وقوع بیشتر شکست های تک رشته ای در DNA این افراد می شوند که در صورت عدم ترمیم به شکست های دورشته ای تبدیل می شوند.
ژن XRCC4 نقش مهمی در مسیر ترمیمی NHEJ دارد و بیان این ژن در مغز بالا می باشد. مسیر NHEJ، مسیر اصلی در ترمیم شکست های دو رشته ای می باشد. با توجه به نظریه ای که اسکیزوفرنی را یک بیماری همراه با تحلیل نورونی می داند می توان نقص درژن XRCC4 را با این بیماری مرتبط دانست .(Van der Schyf et al., 2006)
انتظار می رود افراد با ژنوتیپ D/D نسبت به افراد با ژنوتیپ I/I در معرض خطر بیشتری برای ابتلا به اسکیزوفرنیا باشند. با این احتمال که شکست های حاصل از ژئوتوکسیک های خارجی یا داخلی موجود در DNA افراد با ژنوتیپ D/D به طور موثر ترمیم نشده و منجر به افزایش آپوپتوز، در سیستم عصبی این افراد و در نتیجه افزایش خطر ابتلا به بیماری اسکیزوفرنیا می شود. بدین منظور مطالعه مورد-شاهدی حاضر، انجام شد. این مطالعه اولین مطالعه ای است که به بررسی ارتباط بین پلی مورفیسم I/D ژن XRCC4 و بیماری اسکیزوفرنیا پرداخته است. بر اساس مطالعه حاضر ارتباط معنادار بین ژنوتیپ D/D و بیماری اسکیزوفرنی مشاهده نشد. مطالعاتی که تاکنون به بررسی این چند شکلی پرداخته اند
تفاوت های آشکاری را نشان می دهند. نتایج حاصل از مطالعه این چند شکلی در کشور ما بسیار شبیه به نتایج مشاهده شده در کشور تایوان است که به بررسی ارتباط بین این چند شکلی و سرطان های پروستات، معده و مثانه پرداخته است. همچنین نتایج حاصل از مطالعه ما تفاوت آشکاری با نتایج حاصل از کشورهای تایوان و شمال هند دارد که به ترتیب آلل D را ریسک فاکتوری برای بیماری های لوکمیا و سرطان پروستات می دانند
(Wu et al., 2010, Chang et al., 2009, Hsieh et al., 2008, Mandal et al., 2011). این امرممکن است دلایل متعددی داشته باشد از جمله این که اختلال اسکیزوفرنی منشا چند عاملی دارد، بنابراین نقش فاکتورهای محیطی نباید فراموش شود. هم چنین بیش از 150 ژن در مسیرهای مختلف ترمیمی شرکت دارند که با یکدیگر همپوشانی قابل ملاحظه ای دارند. بنابراین نقص در یک سیستم ترمیمی ممکن است به وسیله سایر مکانیسم ها، جبران شود. همچنین، در مسیر آپوپتوز که کانون بحث ما بوده است، ژن های مختلفی درگیر هستند که می توانند با عملکرد یکدیگر تداخل داشته باشند (Lindahl et al., 1995). در نهایت سبب شناسی یک بیماری چند عاملی به وسیله تغییر پذیری آللی یک لوکوس منفرد نمی تواند توضیح داده شود. بنابراین با بررسی ژن ها و فاکتورهای موثر دیگر شاید بتوان رابطه بدست آمده را توجیه کرد .(Kiyohara et al., 2006) آنزیم ACE در کنار اعمالش بر روی قلب و رگ های خونی، سیستم آندوکرین و سیستم سمپاتیک، باعث تبدیل Ang I به Ang IIدر سیستم رنین- آنژیوتنسین می شود (Crescenti et al., 2009). آنژیوتنسین سنتز شده دارای اثرات مهمی در مغز می باشد. از جمله تحریک آزادسازی دوپامین تازه سنتز شده از منطقه Striatum در مغز که منجر به افزایش سطح دوپامین در جسم مخطط می شود. علاوه بر این Ang II باعث آزادسازی نورآدرنالین از چندین منطقه در مغز می شود
.(Levinson et al., 2003)
در واقع مطالعات رفتاری در موش بر اساس مهار پاسخ تشنگی ایجاد شده توسط Ang IIبه وسیله آنتاگونیست های دوپامین، بر هم کنش بین آنژیوتنسین مغز و دوپامین را پیشنهاد کرد. در ذیل به تعدادی از فاکتورها که باعث می شوند ACE یک ژن کاندید برای بیماری های روانی باشد اشاره می شود:
1-Ang II یک نوروترانسمیتر است که بر روی دوپامین موجود در منطقه مزوکورتیکولیمبیک مغز اثر دارد و هم چنین باعث آزادسازی دوپامین از منطقه Striatum مغز می شود.
2- ACE فعالیت دوپامین را در منطقه Striatum تعدیل می کند.
3- تعدادی از مطالعات وابستگی بین سطح ACE موجود در مایع مغزی- نخاعی را با بیماری های روانی گزارش کرده اند.
4- تعدادی از مطالعات پیشنهاد کردند ماده P که یک شکل فرعی نروپپتید برای آنزیم ACE می باشد، نقش مهمی در سبب شناسی بیماری های روانی از جمله اسکیزوفرنی دارد (Crescenti et al., 2009).
این مطالعه اولین مطالعه در ایران است که به بررسی ارتباط بین



قیمت: تومان

دسته بندی : مقاله و پایان نامه

دیدگاهتان را بنویسید